si:dkey-108d22.4

Ensembl ID:
ENSDARG00000063299
ZFIN ID:
ZDB-GENE-030131-8115
Description:
Novel protein similar to vertebrate piccolo (Presynaptic cytomatrix protein) (PCLO) [Source:UniProtK
Human Orthologue:
BSN
Human Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:
Bsn
Mouse Description:
bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26245 Nonsense Mutation detected in F1 DNA During 2017
sa26246 Nonsense Mutation detected in F1 DNA During 2017
sa9380 Nonsense Mutation detected in F1 DNA During 2017
sa1417 Nonsense Available for shipment Available now
sa33409 Nonsense Mutation detected in F1 DNA During 2017
sa33410 Nonsense Mutation detected in F1 DNA During 2017
sa33411 Nonsense Mutation detected in F1 DNA During 2017
sa33412 Nonsense Mutation detected in F1 DNA During 2017
sa40241 Nonsense Mutation detected in F1 DNA During 2017
sa17573 Nonsense Available for shipment Available now
sa33413 Essential Splice Site Available for shipment Available now
sa20227 Nonsense Available for shipment Available now
sa11716 Nonsense Available for shipment Available now
sa20228 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 24 4152 1 32
ENSDART00000136117   None 3096 None 15
ENSDART00000143963   None 3298 None 20
Genomic Location (Zv9):
Chromosome 4 (position 10451602)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11388229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAAAGGGTCCTCCTCAAGGGAGTAAGCCACCTCAGCAGGGTCCCCCT[A/T]AAGGGCAGGGACCTCTTCAGCAAGGGCCCAAACCTGGTGGACCAGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 335 4152 2 32
ENSDART00000136117   None 3096 None 15
ENSDART00000143963   None 3298 None 20
Genomic Location (Zv9):
Chromosome 4 (position 10453284)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11389911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACCACAGCAGGGACCTCAGCCTGGACAACTAGGGGCAAAACGTGGA[C/T]AGCCTCCACCACTTCAGAAACCTTCACAGAGCCCAAAAGGTAGTCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1261 4152 10 32
ENSDART00000136117 Nonsense 409 3096 1 15
ENSDART00000143963 Nonsense 409 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10480040)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11416667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGARCTAAGACAGGARGCAGAAATGGAGGAAATCCGCAGGTCTTCCTG[C/A]TCAGACCTCTCCCCAAGCATRGATTCAGAACCAGAGAGTTTTGAGMTWCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1878 4152 10 32
ENSDART00000136117 Nonsense 1026 3096 1 15
ENSDART00000143963 Nonsense 1026 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10481889)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11418516
KASP Assay ID:
554-1338.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGCAGTCACAAACAACTAGAGTACCACTGGCATTCACACGGATAACT[G/T]AATCTATTGAAAGTCAAGAAATTTGTGGTCCAGAGAAAGTAGTTTCTAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1968 4152 10 32
ENSDART00000136117 Nonsense 1116 3096 1 15
ENSDART00000143963 Nonsense 1116 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10482161)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11418788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAAACTACTAAACCTGAAGCAGTTCAAATACAGAATGGTCATGCCTA[T/A]CATCCTGGTGAAGTAGTGGATCTCCGAACCCCAAAAATAGATGCAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1996 4152 10 32
ENSDART00000136117 Nonsense 1144 3096 1 15
ENSDART00000143963 Nonsense 1144 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10482243)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11418870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAATAGATGCAGTAACATCCATGAAAGGTATAGATCTGTCTTCCTCT[G/T]AATCAAGGCGACAGTCTCTTGCTGTTGATAGTGGTGGACGTCAACAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 2465 4152 11 32
ENSDART00000136117 Nonsense 1613 3096 2 15
ENSDART00000143963 Nonsense 1613 3298 2 20
Genomic Location (Zv9):
Chromosome 4 (position 10483917)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11420544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAAAATAAAGCAGCAGCGCTTAGCTGAAGAGCTTGAGTGGGAGAGG[C/T]AGGAGATACAGCGTTTCCGTGAGCAGGAGCAACTTCTTGTGCAGAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 2514 4152 11 32
ENSDART00000136117 Nonsense 1662 3096 2 15
ENSDART00000143963 Nonsense 1662 3298 2 20
Genomic Location (Zv9):
Chromosome 4 (position 10484064)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11420691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAGAGACAAGCCCACCTAATGATGCAAAAGGAAACTTATGCGCAG[C/T]AACAGGAACAGTTAGAGCAGATCCAAAGACTTCAGGAACAGCTGAGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3009 4152 12 32
ENSDART00000136117 Nonsense 2157 3096 3 15
ENSDART00000143963 Nonsense 2157 3298 3 20
Genomic Location (Zv9):
Chromosome 4 (position 10486088)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11422715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACAGAGCTACCACCAAATGCTCTTGCTCCAGCAGAAAGCCAGACAA[C/T]AAGCTGCTCTCCTCTCTGAATTAGATTCTACAAAAATTGCATCTAGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3358 4152 13 32
ENSDART00000136117 Nonsense 2514 3096 3 15
ENSDART00000143963 Nonsense 2514 3298 3 20
Genomic Location (Zv9):
Chromosome 4 (position 10487160)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11423787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGCAGAAGGTGAAGCCTCTTCTGAGACCTCAGCATTCCAGACTCCCT[C/A]GGGCAGGTCAAAACCTACAAGCCTCCCYATTGTACAAAGTGGGCGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Essential Splice Site 3508 4152 15 32
ENSDART00000136117 Essential Splice Site 2642 3096 5 15
ENSDART00000143963 Essential Splice Site 2642 3298 5 20
Genomic Location (Zv9):
Chromosome 4 (position 10490468)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11427095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACAAAGATTGTAAAGAAATATTTGTCTGAATGTGCTTATGCATCTTT[A/G]GGGAAAGTTTCACTACCCGTTTCCTCATGCAAGAATAAAACTACTGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3566 4152 16 32
ENSDART00000136117 Nonsense 2700 3096 6 15
ENSDART00000143963 Nonsense 2700 3298 6 20
Genomic Location (Zv9):
Chromosome 4 (position 10492398)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11429025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGACATCGGTGCATATGTGGCCAAAGTATTACCTGGAGGAGCAGCA[G/T]AACAGACGGGGAAGATTGTGGAAGGTAGGCACCTCAATGAAAGGCGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3580 4152 17 32
ENSDART00000136117 Nonsense 2714 3096 7 15
ENSDART00000143963 Nonsense 2714 3298 7 20
Genomic Location (Zv9):
Chromosome 4 (position 10496209)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11432836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTTATATTTGTATGTGTGTRTTTGCATAGGAATGCAAGTCCTGGAGT[G/A]GAACAACATTTCMTTGAGTGGTAARACGTAMGAGGAGGTGCAAGGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Essential Splice Site 3696 4152 20 32
ENSDART00000136117 Essential Splice Site 2830 3096 10 15
ENSDART00000143963 Essential Splice Site 2830 3298 10 20
Genomic Location (Zv9):
Chromosome 4 (position 10497178)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11433805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAACAAAAAAACACGTCTTTCCTTACTGCTGATGTTTTTTGTTTCTT[A/T]GAACTCTGAGGGTACAAAAACTCAGTCCCACCCAGTTTCAGGAGAAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link