abcb6

Ensembl ID:
ENSDARG00000063297
ZFIN ID:
ZDB-GENE-050517-9
Description:
ATP-binding cassette sub-family B member 6, mitochondrial [Source:RefSeq peptide;Acc:NP_001139165]
Human Orthologue:
ABCB6
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 6 [Source:HGNC Symbol;Acc:47]
Mouse Orthologue:
Abcb6
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1921354]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39536 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19409 Nonsense Available for shipment Available now
sa19410 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Essential Splice Site 476 851 9 20
Genomic Location (Zv9):
Chromosome 1 (position 5013797)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5452359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAGTTACGAAGTGGGCCGCTTTGAGGACGCCATCCTGAAATACCAG[G/A]TAAAGTGTTTTTAGGTACCAAATTGGTTGTGTTTTATAGTTAATTAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Nonsense 755 851 18 20
Genomic Location (Zv9):
Chromosome 1 (position 5020630)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5459192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCATCCTCTACCTGCAGGCCACATCTGCTCTAGACACTCAGACTGAG[C/T]GAAACATTCAGGCCTCGCTGGCTAAAGTCTGCGCCAACAGAACCACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Essential Splice Site 776 851 18 20
Genomic Location (Zv9):
Chromosome 1 (position 5020695)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5459257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGGCTAAAGTCTGCGCCAACAGAACCACAGTTGTTGTGGCACACAG[G/A]TAAACAACAAATGAATTAAGTCATGCTTTCACTAAAACCAGCTTCATTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link