myh9a

Ensembl ID:
ENSDARG00000063295
ZFIN IDs:
ZDB-GENE-030131-5870, ZDB-GENE-030131-5870
Description:
myosin, heavy chain 9, non-muscle, like-2 [Source:RefSeq peptide;Acc:NP_001091647]
Human Orthologue:
MYH9
Human Description:
myosin, heavy chain 9, non-muscle [Source:HGNC Symbol;Acc:7579]
Mouse Orthologue:
Myh9
Mouse Description:
myosin, heavy polypeptide 9, non-muscle Gene [Source:MGI Symbol;Acc:MGI:107717]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20632 Nonsense Mutation detected in F1 DNA During 2014
sa3584 Nonsense Mutation detected in F1 DNA During 2014
sa2301 Nonsense Available for shipment Available now
sa18153 Nonsense Available for shipment Available now
sa5350 Nonsense F2 line generated During 2014
sa15720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011353 Nonsense 360 1046 11 25
ENSDART00000105232 Nonsense 357 1960 9 39
Genomic Location:
Chromosome 6 (position 7676631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTCTGAAGGTGGTGTCTGCTGTATTACAGCTGGGAAACATGAGTTTT[A/T]AAAAGGAACGCAACTCTGACCAAGCCTCCATGCCCGATGATACAGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011353 Nonsense 504 1046 13 25
ENSDART00000105232 Nonsense 502 1960 11 39
Genomic Location:
Chromosome 6 (position 7675409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATGTTCATCCTGGAGCAGGAGGAGTATCAGCGGGAAGGCATCGAAT[G/A]GAGCTTCATCGACTTCGGTCTTGACCTGCAGCCCTGCATTGAACTCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011353 None None 1046 None 25
ENSDART00000105232 Nonsense 1055 1960 23 39
Genomic Location:
Chromosome 6 (position 7669394)
KASP Assay ID:
554-2806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAGGAAGAGAAAATGAGGCAGGAGTTGGAGAAGAACAGGAGGAAGT[T/A]GGAGGGCGACTCTACAGAGCTGCATGATCAGATCGCAGAGCTGCAGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011353 None None 1046 None 25
ENSDART00000105232 Nonsense 1411 1960 29 39
Genomic Location:
Chromosome 6 (position 7664846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAGGTGGAAAGTGTCCKGCAGCAGTTGGAGGAGAGAAATGCCAGCTA[C/A]GATAAACTGGATAAGACCAAGACACGTCTGCAGCGGGAGCTTGATGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5350
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011353 None None 1046 None 25
ENSDART00000105232 Nonsense 1684 1960 33 39
Genomic Location:
Chromosome 6 (position 7659630)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTAACCAGGCCAAAGAAAACGAGCGCAAGATCAAGAGCATGGAAGCC[G/T]AGATCATGCAACTACATGAGGTTTGTCTTGCATTTTTNNAAGGATGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011353 None None 1046 None 25
ENSDART00000105232 Nonsense 1891 1960 38 39
Genomic Location:
Chromosome 6 (position 7656045)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGAAGCAGATGAAGAGGCAGCTGGAGGAGACTGAGGAGGAAGCGGCT[C/T]GAGCAAACGCCTCCTGCAGGAAACTGCGGAGAGAGCTGGAGGAYGCCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0w5apul3