LOC100330283

Ensembl ID:
ENSDARG00000063282
Human Orthologue:
KCNA3
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 3 [Source:HGNC Symbol;Acc:6221]
Mouse Orthologue:
Kcna3
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5024 Nonsense Mutation detected in F1 DNA During 2016
sa37608 Nonsense Mutation detected in F1 DNA During 2016
sa3232 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa5024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092321 Nonsense 33 482 1 1
Genomic Location:
Chromosome 23 (position 5077576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCGGGCACCACTCTCYGGAGCGCTACGAGCCCGACCATGAGTGTTGC[G/T]AGAGAGTTGTCATCAACATCTCGGGCTTGAGGTTCGAGACGCAGCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092321 Nonsense 65 482 1 1
Genomic Location:
Chromosome 23 (position 5077672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACCCTGTCCCAGTTCCCCGAGACGTTGCTTGGAGACCCCAAGAAA[C/T]GAATGCGCTACTTTGACCCACTCAGAAACGAATATTTCTTTGACAGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3232
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092321 Nonsense 100 482 1 1
Genomic Location:
Chromosome 23 (position 5077777)
KASP Assay ID:
554-3199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCTTCGATGCCATTTTATATTACTACCAGTCAGGGGGTCGTATTCGG[A/T]GACCAGTAAATRTCCCTATTGACATTTTCTCCGAGGAGATTCGCTTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link