LOC100330283

Ensembl ID:
ENSDARG00000063282
Human Orthologue:
KCNA3
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 3 [Source:HGNC Symbol;Acc:6221]
Mouse Orthologue:
Kcna3
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5024 Nonsense Mutation detected in F1 DNA During 2014
sa3232 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092321 Nonsense 33 482 1 1
Genomic Location:
Chromosome 23 (position 5077576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCGGGCACCACTCTCYGGAGCGCTACGAGCCCGACCATGAGTGTTGC[G/T]AGAGAGTTGTCATCAACATCTCGGGCTTGAGGTTCGAGACGCAGCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3232
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092321 Nonsense 100 482 1 1
Genomic Location:
Chromosome 23 (position 5077777)
KASP Assay ID:
554-3199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCTTCGATGCCATTTTATATTACTACCAGTCAGGGGGTCGTATTCGG[A/T]GACCAGTAAATRTCCCTATTGACATTTTCTCCGAGGAGATTCGCTTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kfcdybdq