A2CE81_DANRE

Ensembl ID:
ENSDARG00000063276
Description:
Novel protein similar to vertebrate mutS homolog 3 (E. coli) (MSH3) [Source:UniProtKB/TrEMBL;Acc:A2C
Human Orthologue:
MSH3
Human Description:
mutS homolog 3 (E. coli) [Source:HGNC Symbol;Acc:7326]
Mouse Orthologue:
Msh3
Mouse Description:
mutS homolog 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:109519]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa203 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa203
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092285 Nonsense 42 957 1 21
ENSDART00000141930 Nonsense 42 893 1 20
Genomic Location:
Chromosome 5 (position 52935263)
KASP Assay ID:
554-0111.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCACTAATGCAAGCGATCGGGCTCAACCAACTGAGCAGATTAACTG[T/A]CAAGACCGACGCCATGAGGGCAGAGGGAAGGTAAGAGAGAGAGATAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6s0wmwvv