fam134a

Ensembl ID:
ENSDARG00000063270
ZFIN ID:
ZDB-GENE-061215-128
Description:
hypothetical protein LOC564232 [Source:RefSeq peptide;Acc:NP_001073483]
Human Orthologue:
FAM134A
Human Description:
family with sequence similarity 134, member A [Source:HGNC Symbol;Acc:28450]
Mouse Orthologue:
Fam134a
Mouse Description:
family with sequence similarity 134, member A Gene [Source:MGI Symbol;Acc:MGI:2388278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15479 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092277 Nonsense 96 545 2 9
ENSDART00000146473 None None 270 None 2

The following transcripts of ENSDARG00000063270 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 5056622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACATCCCTGAGGCCTCTGTTTCTCCTGAGTGTTTTTCTCATTGGTT[T/A]GACTCTRCTGGAGAGATGGAAAGACAAGCTGCCACAGATCACCGGTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dw1kj8d5