PLD5 (1 of 2)

Ensembl ID:
ENSDARG00000063257
Description:
phospholipase D family, member 5 [Source:HGNC Symbol;Acc:26879]
Human Orthologue:
PLD5
Human Description:
phospholipase D family, member 5 [Source:HGNC Symbol;Acc:26879]
Mouse Orthologue:
Pld5
Mouse Description:
phospholipase D family, member 5 Gene [Source:MGI Symbol;Acc:MGI:2442056]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20618 Nonsense Available for shipment Available now
sa15055 Nonsense Available for shipment Available now
sa33797 Nonsense Mutation detected in F1 DNA During 2017
sa20617 Nonsense Available for shipment Available now
sa26671 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092257 Nonsense 134 481 4 10
Genomic Location (Zv9):
Chromosome 6 (position 6323787)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6249803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTCAATATTTGTTTCAGAGATTGTTAAGCCTGAAGTCTCGAGGTGTC[A/T]AATTAAAGGTTGTCAGTGACCAACCCAACTCCACTGAGCTGAAGAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092257 Nonsense 167 481 5 10
Genomic Location (Zv9):
Chromosome 6 (position 6322533)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6248549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTCCCGCAGATGCCGAAGTTCGCTRTGTCAACATGACGGCCCTCACC[A/T]GAGGACGACTKCTTTYCTCCTTTTGGGTCGTGGACAGGAAGCACATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092257 Nonsense 285 481 7 10
Genomic Location (Zv9):
Chromosome 6 (position 6315358)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6241374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCCCGAAGGGTCGGAGTCGAGATATAGATGCTATACGACATGTGATC[C/T]GAGAAGCGAAGAGATACATTTACATCTCTGTAACTGATTACCTGCCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092257 Nonsense 315 481 8 10
Genomic Location (Zv9):
Chromosome 6 (position 6313404)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6239420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATCAACAGTTATGTGGCTTGTCATGTTATTTCTTGCTTCAGGTACTG[G/A]TCGCCAATAGATGAGATGCTCCGCGAGGCTGCAGTACTGAAAGAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092257 Essential Splice Site 369 481 9 10
Genomic Location (Zv9):
Chromosome 6 (position 6313130)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6239146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACACCGGCTGGATTTTACAGTATATATGCATGTCTGTTTTTTAATTC[A/T]GAGATTTTACAGAGGCAAGGAGCAGATGGGCGGATTTCAGCACAGGATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link