btbd11a

Ensembl ID:
ENSDARG00000063255
ZFIN ID:
ZDB-GENE-050419-142
Description:
Ankyrin repeat and BTB/POZ domain-containing protein BTBD11-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LVW
Human Orthologue:
BTBD11
Human Description:
BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:23844]
Mouse Orthologue:
Btbd11
Mouse Description:
BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1921257]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1228 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Nonsense 380 1021 3 17
ENSDART00000141944 Nonsense 91 732 2 16
Genomic Location:
Chromosome 4 (position 10913708)
KASP Assay ID:
554-1137.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCACCAGAACCGCACGGGCTCCGTTCACTGGGAGCCCGAGGCCCTCTA[T/A]ACGCTCTGCTACTTCATGCACTGTCCGCAGATGGAGTGGGAAAACCCTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ugknncxp