btbd11a

Ensembl ID:
ENSDARG00000063255
ZFIN ID:
ZDB-GENE-050419-142
Description:
Ankyrin repeat and BTB/POZ domain-containing protein BTBD11-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LVW
Human Orthologue:
BTBD11
Human Description:
BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:23844]
Mouse Orthologue:
Btbd11
Mouse Description:
BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1921257]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40246 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1228 Nonsense Available for shipment Available now
sa31385 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Essential Splice Site 340 1021 2 17
ENSDART00000141944 Essential Splice Site 51 732 1 16
Genomic Location (Zv9):
Chromosome 4 (position 10940376)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11877003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAACAGTCACTTCTGGCGACCCGTGTGGGGAGCATCGCCGAGCTCAG[T/G]AAGTACTCATGCCTTAAAAATGAGTTAGTAGGTTATAGTTATGTCATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Nonsense 380 1021 3 17
ENSDART00000141944 Nonsense 91 732 2 16
Genomic Location (Zv9):
Chromosome 4 (position 10913708)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11850335
KASP Assay ID:
554-1137.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCACCAGAACCGCACGGGCTCCGTTCACTGGGAGCCCGAGGCCCTCTA[T/A]ACGCTCTGCTACTTCATGCACTGTCCGCAGATGGAGTGGGAAAACCCTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Essential Splice Site 888 1021 15 17
ENSDART00000141944 Essential Splice Site 599 732 14 16
Genomic Location (Zv9):
Chromosome 4 (position 10883352)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11819979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCTCAAATGTTTCTTGGAAGTCTGAGAACATCTCATTGTTTTTTTC[A/G]GCTGGTAATGCAGTACCTCTACTGTGGCGGCACTGAGTCACTGCACATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link