HECW2 (1 of 2)

Ensembl ID:
ENSDARG00000063253
Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 [Source:HGNC Symbol;Acc:29853]
Human Orthologue:
HECW2
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 [Source:HGNC Symbol;Acc:29853]
Mouse Orthologue:
Hecw2
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:2685

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17893 Nonsense Available for shipment Available now
sa19412 Essential Splice Site Available for shipment Available now
sa5933 Nonsense Mutation detected in F1 DNA During 2014
sa18393 Essential Splice Site Available for shipment Available now
sa19413 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090286 Nonsense 186 1567 4 34
Genomic Location:
Chromosome 1 (position 5187466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCATGGTGWTYTCTGCAGGTTGGGGCAGAGGGGCAGGTGGATGGA[C/T]AGTCTGTCACTGAACACWGCAGRAAATTGGTCAGCTTTACWTTATCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090286 Essential Splice Site 202 1567 4 34
Genomic Location:
Chromosome 1 (position 5187516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGTCACTGAACACTGCAGGAAATTGGTCAGCTTTACATTATCAGG[T/C]TAGAAGGTTGATTTTTATCACACTTACACTGATTCAAGCAAATCACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090286 Nonsense 219 1567 5 34
Genomic Location:
Chromosome 1 (position 5190168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGGGCTCAGGGTCTGAAGAAGGGCATGTTTTTTAATCCGGACCCGTA[T/A]CTAAAAATGAGCATYCAACCAGGCAAGAGGAACGGCTTCCCCACGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090286 Essential Splice Site 306 1567 7 34
Genomic Location:
Chromosome 1 (position 5192860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCATAAAGTTTAGTGATCTACTTTTTTCTGTGAWTGTATTTGGAATAAA[G/A]GGATCAACATGTGAGCTACACACTTTGTCGTCGACTRCCAACAGAACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090286 Nonsense 1336 1567 29 34
Genomic Location:
Chromosome 1 (position 5220616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAGATTATTTGACTTCATACGTGTTTGTTTAAACATGTAGCCCGTG[T/A]GATCTGAGTGATCTGGAGTATCTGGATGAGGAGTTTCATCAGAGTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3evxnfzd