mrpl9

Ensembl ID:
ENSDARG00000063249
ZFIN ID:
ZDB-GENE-070717-4
Description:
39S ribosomal protein L9, mitochondrial [Source:RefSeq peptide;Acc:NP_001093514]
Human Orthologue:
MRPL9
Human Description:
mitochondrial ribosomal protein L9 [Source:HGNC Symbol;Acc:14277]
Mouse Orthologue:
Mrpl9
Mouse Description:
mitochondrial ribosomal protein L9 Gene [Source:MGI Symbol;Acc:MGI:2137211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092256 Nonsense 67 248 2 7
Genomic Location:
Chromosome 19 (position 8147090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGGAAGGGAAGCCACCCAGGCTGCATCCCCGCCGTCACAAGGTCTAC[C/T]RACTGGTTGAGGACAAAAAAMACAGTCCRCAGGACAAAATGGAGCTYATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qvo2adkh