BAZ1A (2 of 2)

Ensembl ID:
ENSDARG00000063233
Description:
bromodomain adjacent to zinc finger domain, 1A [Source:HGNC Symbol;Acc:960]
Human Orthologue:
BAZ1A
Human Description:
bromodomain adjacent to zinc finger domain, 1A [Source:HGNC Symbol;Acc:960]
Mouse Orthologue:
Baz1a
Mouse Description:
bromodomain adjacent to zinc finger domain 1A Gene [Source:MGI Symbol;Acc:MGI:1309478]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42873 Nonsense Mutation detected in F1 DNA During 2016
sa9543 Nonsense Available for shipment Available now
sa14102 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092209 Nonsense 225 722 3 17
Genomic Location (Zv9):
Chromosome 17 (position 9907754)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9886926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTGATGGAGAGAAACTCATGGCGAGCTGCGCTCGAAAATGGGAACTA[T/G]GAACTATTAGACCCTGACTTCAAAGAGTATGGGCTAACTGACCGAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092209 Nonsense 465 722 9 17
Genomic Location (Zv9):
Chromosome 17 (position 9902180)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9881352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCCTCTACAGAACAATAAAGGAGGTYGTTCGAACAGCAAATCAAAA[C/T]AAGCTGAATCCGCTAATTCCACGTCCCGCTCGCAGCAGAACACACCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092209 Essential Splice Site 549 722 13 17
Genomic Location (Zv9):
Chromosome 17 (position 9900782)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9879954
KASP Assay ID:
2261-0671.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAATATCTNNYAATGTCAGATTTTTYCAATATCTTGCWGCCCTAATTGA[T/A]GTCATGCAAACMTTTTATTTCAAACTTCAGTTAYTTCACAKGTGAGATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link