bmp7b

Ensembl ID:
ENSDARG00000063230
ZFIN ID:
ZDB-GENE-060929-328
Description:
bone morphogenetic protein 7 [Source:RefSeq peptide;Acc:NP_001070614]
Human Orthologue:
BMP7
Human Description:
bone morphogenetic protein 7 [Source:HGNC Symbol;Acc:1074]
Mouse Orthologue:
Bmp7
Mouse Description:
bone morphogenetic protein 7 Gene [Source:MGI Symbol;Acc:MGI:103302]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37612 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17005 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092214 Essential Splice Site 248 427 3 8
ENSDART00000138020 Essential Splice Site 248 427 3 7
Genomic Location (Zv9):
Chromosome 23 (position 6494190)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6509405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCGGGCCGTAACCTGGGCCTGCAGCTGGCTCTGGACAGTCTGGACGG[T/A]GAGCAAAATGAGCAATGCATTCACAAATCTGCCATTCAGAGAGCACGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092214 Nonsense 267 427 4 8
ENSDART00000138020 Nonsense 267 427 4 7
Genomic Location (Zv9):
Chromosome 23 (position 6488739)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6503954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGAACCCCTGGGTGGCGGGACTGGTGGGGCGCAGTGGCCCTCAGAGC[A/T]AACAGCCCTTCATGGTGGCCTTCTTCAAAGCCACGGAGGTCCACATCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link