xpo1

Ensembl ID:
ENSDARG00000063229
ZFIN ID:
ZDB-GENE-070530-6
Human Orthologue:
XPO1
Human Description:
exportin 1 (CRM1 homolog, yeast) [Source:HGNC Symbol;Acc:12825]
Mouse Orthologue:
Xpo1
Mouse Description:
exportin 1, CRM1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2144013]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10716 Nonsense Available for shipment Available now
sa7435 Missense Mutation detected in F1 DNA During 2014
sa7436 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Nonsense 78 1074 3 24
Genomic Location:
Chromosome 17 (position 23801485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTYGGGTCATTAATGCTTGATTTGYTCTCTTGGCATTACAGYACTA[T/A]GCTCTGCAGATTCTGGAAACAGTTATTAAAACAAGATGGAAGATTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Missense 459 1074 12 24
Genomic Location:
Chromosome 17 (position 23804256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCGAGAATTCAKGAAGGATACAGACTCCATTAATCTATACAAGAACA[T/G]GAGGGAGACACTTGGTGAGAACTTAGTCATTCTTCACTTTTAATGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Missense 642 1074 16 24
Genomic Location:
Chromosome 17 (position 23805823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATTTCCTGTTTTCAGGTGCACACGTTTTACGAAGCTGTTGGGTATA[T/G]GATTGGAGCGCAGACCGACCAGGCTGTGCAGGAACACCTGATAGAGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jr4hsa3x