mtif2

Ensembl ID:
ENSDARG00000063213
ZFIN ID:
ZDB-GENE-030131-1092
Description:
translation initiation factor IF-2, mitochondrial [Source:RefSeq peptide;Acc:NP_001082793]
Human Orthologue:
MTIF2
Human Description:
mitochondrial translational initiation factor 2 [Source:HGNC Symbol;Acc:7441]
Mouse Orthologue:
Mtif2
Mouse Description:
mitochondrial translational initiation factor 2 Gene [Source:MGI Symbol;Acc:MGI:1924034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa692 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092172 Nonsense 246 705 6 14

The following transcripts of ENSDARG00000063213 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 6205903)
KASP Assay ID:
554-0600.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGATATCGTCATCCTGGTGGTCGCAGCTGATGATGGTGTGATGAAA[C/T]AGACCATTGAGTCCATAGAGCTCGCCAAAAAAGCCAAAGGTAGCCTGCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ho36xg91