erbb4a

Ensembl ID:
ENSDARG00000063207
ZFIN ID:
ZDB-GENE-030918-4
Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4a [Source:RefSeq peptide;Acc:NP_001137223]
Human Orthologue:
ERBB4
Human Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Mouse Orthologue:
Erbb4
Mouse Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene [Source:MGI Symbol;Acc:MGI:104

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39540 Nonsense Mutation detected in F1 DNA During 2016
sa39541 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8456 Nonsense Mutation detected in F1 DNA During 2016
sa25516 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092118 Nonsense 13 1388 1 26
ENSDART00000145822 Nonsense 13 1296 1 28
Genomic Location:
Chromosome 1 (position 5694991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTCTCTATAGTGTGTCCTGGCACTGATAACAAGCTCAGCACGCTGT[C/A]GGATTTGGACCAGCAGTACAAAACTCTTCGTAAGTTCTACGAGAACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092118 Essential Splice Site 698 1388 18 26
ENSDART00000145822 Essential Splice Site 742 1296 19 28
Genomic Location:
Chromosome 1 (position 5765764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTATATGGTGTGAAAGGTTATTGACTGATTCTGATGCCTTCTTTAAA[A/T]GGGAATCTGGGTTCCAGAAGGGGAAACAGTGAAGATTCCTGTGGCCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092118 Nonsense 796 1388 20 26
ENSDART00000145822 Nonsense 840 1296 21 28
Genomic Location:
Chromosome 1 (position 5787352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGATAATCCATGGTGTTTTTGRACYTTTTCGGCAGGGTATGATGTA[T/A]CTGGAGGAGAGACGGCTGGTGCACAGGGATCTTGCARCTCGTAACGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092118 Nonsense 1012 1388 25 26
ENSDART00000145822 Nonsense 1056 1296 26 28
Genomic Location:
Chromosome 1 (position 5796300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTAATGCACCTAATCTTTACTTTTGTCCCACATATAGACTCTGAGGTG[T/A]CGTGACAGGGTTTTCAGTCCTGAAGACGGGATGGGGGCTTGTTCTCGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link