erbb4a

Ensembl ID:
ENSDARG00000063207
ZFIN ID:
ZDB-GENE-030918-4
Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4a [Source:RefSeq peptide;Acc:NP_001137223]
Human Orthologue:
ERBB4
Human Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Mouse Orthologue:
Erbb4
Mouse Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene [Source:MGI Symbol;Acc:MGI:104

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8456 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092118 Nonsense 796 1388 20 26
ENSDART00000145822 Nonsense 840 1296 21 28
Genomic Location:
Chromosome 1 (position 5787352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGATAATCCATGGTGTTTTTGRACYTTTTCGGCAGGGTATGATGTA[T/A]CTGGAGGAGAGACGGCTGGTGCACAGGGATCTTGCARCTCGTAACGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cq9tatss