lin54

Ensembl ID:
ENSDARG00000063194
ZFIN ID:
ZDB-GENE-060929-440
Description:
Protein lin-54 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08CM4]
Human Orthologue:
LIN54
Human Description:
lin-54 homolog (C. elegans) [Source:HGNC Symbol;Acc:25397]
Mouse Orthologue:
Lin54
Mouse Description:
lin-54 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2140902]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2567 Nonsense F2 line generated During 2014
sa18399 Nonsense Available for shipment Available now
sa4362 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2567
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092110 Nonsense 41 771 2 14
ENSDART00000135527 Nonsense 41 211 2 2
ENSDART00000092110 Nonsense 41 771 2 14
ENSDART00000135527 Nonsense 41 211 2 2

The following transcripts of ENSDARG00000063194 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 11313908)
KASP Assay ID:
554-3260.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATYCGCCTGCTTCACATCTTACCCCTCCGCCCCAATCTGCCCCAGAGT[C/A]GGCGCAGGTACCAATGGAAACAGAGGTGCCTGAAATCATTAGCATTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092110 Nonsense 86 771 2 14
ENSDART00000135527 Nonsense 86 211 2 2

The following transcripts of ENSDARG00000063194 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 11313773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTAAAAGTACCACMAGYTCMACAACTCAACTCCTACTCACCCCATCAT[C/A]ATCCTCCTCCACCACTACAAAAAACGCCACTCCGACCCTCCCCAAAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092110 Essential Splice Site 638 771 None 14
ENSDART00000135527 None None 211 None 2

The following transcripts of ENSDARG00000063194 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 11298082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTGCAAGAAATCTGGCTGTCTGAAAAATTACTGCGAGTGCTATGAGG[T/C]GAGCATTTACAGTACACGGGTCAAGGGGCAAGAAATGTGGAACGACCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/urfnz1z5