lin54

Ensembl ID:
ENSDARG00000063194
ZFIN ID:
ZDB-GENE-060929-440
Description:
Protein lin-54 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08CM4]
Human Orthologue:
LIN54
Human Description:
lin-54 homolog (C. elegans) [Source:HGNC Symbol;Acc:25397]
Mouse Orthologue:
Lin54
Mouse Description:
lin-54 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2140902]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2567 Nonsense F2 line generated During 2016
sa18399 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2567
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092110 Nonsense 41 771 2 14
ENSDART00000135527 Nonsense 41 211 2 2
ENSDART00000092110 Nonsense 41 771 2 14
ENSDART00000135527 Nonsense 41 211 2 2

The following transcripts of ENSDARG00000063194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 11313908)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11389774
KASP Assay ID:
554-3260.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATYCGCCTGCTTCACATCTTACCCCTCCGCCCCAATCTGCCCCAGAGT[C/A]GGCGCAGGTACCAATGGAAACAGAGGTGCCTGAAATCATTAGCATTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092110 Nonsense 86 771 2 14
ENSDART00000135527 Nonsense 86 211 2 2

The following transcripts of ENSDARG00000063194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 11313773)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11389639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTAAAAGTACCACMAGYTCMACAACTCAACTCCTACTCACCCCATCAT[C/A]ATCCTCCTCCACCACTACAAAAAACGCCACTCCGACCCTCCCCAAAATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link