DOCK3

Ensembl ID:
ENSDARG00000063180
Description:
dedicator of cytokinesis 3 [Source:HGNC Symbol;Acc:2989]
Human Orthologue:
DOCK3
Human Description:
dedicator of cytokinesis 3 [Source:HGNC Symbol;Acc:2989]
Mouse Orthologue:
Dock3
Mouse Description:
dedicator of cyto-kinesis 3 Gene [Source:MGI Symbol;Acc:MGI:2429763]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18344 Essential Splice Site Available for shipment Available now
sa24207 Nonsense Mutation detected in F1 DNA During 2017
sa24208 Nonsense Available for shipment Available now
sa1627 Essential Splice Site Available for shipment Available now
sa37557 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9819 Essential Splice Site Available for shipment Available now
sa37558 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 497 1938 13 57
Genomic Location (Zv9):
Chromosome 22 (position 34948130)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32187827
KASP Assay ID:
2261-7023.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCTCTGGATAWCAACRCAACTCTCTTCCACCAAACTAACACAGAATG[G/A]TAACATACTAAAGCCAYGTTCACATGTACACTGRTATTTTAYAAATKACN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 841 1938 24 57
Genomic Location (Zv9):
Chromosome 22 (position 34975471)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32215168
KASP Assay ID:
2261-7024.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTAAATTCACTAAGAATATACTGTAATAACATTACATGTTTGCAAACA[C/T]AACTCATTTTGTTTATAAAGTGTCTAGGGACTCCACTGACCCAAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 1146 1938 35 57
Genomic Location (Zv9):
Chromosome 22 (position 34998359)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32238056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGACCTGAGAGTCACATGATCTGGACGTTTACAGAATTTCTACAAGT[C/A]GGAGATCAATAAGGAGGAGATGTACATCCGATACATTCATAAGCTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1389 1938 40 57
Genomic Location (Zv9):
Chromosome 22 (position 35009609)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32249306
KASP Assay ID:
554-1568.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACCGACCATTCCACAAGGGTCCTAAAGACCGGGAGAATGAGTTCAAG[G/A]TAAAATTATGCCTCTCTTCACTTSTGGATTATGATGAACCGCATGTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1698 1938 51 57
Genomic Location (Zv9):
Chromosome 22 (position 35020839)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32260536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATCGGCCCAGTAGTGCCATGTACCCCAATATAACTGAGAATGGACAG[G/A]TGGTGTGTTTACCTTTCAAACAATTAATTTAGTTTAAAATTCATCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1771 1938 55 57
Genomic Location (Zv9):
Chromosome 22 (position 35023923)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32263620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCATGTCCGCGMTAGCATTCCACGATGTCTAATGTCCTGTTAACCTCA[G/T]ATGTCCCCACCTGTTCTCCAGCCAAAACACCCAGAGCCGAATTGTCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1791 1938 55 57
Genomic Location (Zv9):
Chromosome 22 (position 35023987)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32263684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCAGCCAAAACACCCAGAGCCGAATTGTCCGCCAGTCTGCTTTTGG[T/C]TATAATTGGGTTGTTCTTGTCCCTAAGATGCTGAAAGTGTTTGGGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 1870 1938 56 57
Genomic Location (Zv9):
Chromosome 22 (position 35025722)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32265419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCACAGACACGGAAGAGGCAGAAAGTCCCTATCTCCCCGTACGCTA[C/A]AGCGTCTCCGAGCCTGAAGTTCTGGACCCTCTCAAGCCMGCTCCATGCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link