manf

Ensembl ID:
ENSDARG00000063177
ZFIN ID:
ZDB-GENE-060929-640
Description:
mesencephalic astrocyte-derived neurotrophic factor [Source:RefSeq peptide;Acc:NP_001070097]
Human Orthologues:
AC092037.1, MANF
Human Descriptions:
mesencephalic astrocyte-derived neurotrophic factor [Source:HGNC Symbol;Acc:15461]
Mesencephalic astrocyte-derived neurotrophic factor [Source:UniProtKB/Swiss-Prot;Acc:P55145]
Mouse Orthologue:
Manf
Mouse Description:
mesencephalic astrocyte-derived neurotrophic factor Gene [Source:MGI Symbol;Acc:MGI:1922090]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37559 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092082 Nonsense 122 180 4 4
Genomic Location (Zv9):
Chromosome 22 (position 35040100)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32279797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATATCCATTACATGCTGCTGTTTTTCCCCTTCCGTCCTCTAGATAAA[C/T]AAGTTGACTTGAGCTCCGTCGACCTTAAGAAGCTGAAAGTGAAAGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link