chkb

Ensembl ID:
ENSDARG00000063167
ZFIN ID:
ZDB-GENE-030131-2928
Description:
choline/ethanolamine kinase [Source:RefSeq peptide;Acc:NP_001093482]
Human Orthologues:
CHKB, CTA-384D8.32
Human Descriptions:
choline kinase beta [Source:HGNC Symbol;Acc:1938]
choline/ethanolamine kinase [Source:RefSeq peptide;Acc:NP_005189]
Mouse Orthologue:
Chkb
Mouse Description:
choline kinase beta Gene [Source:MGI Symbol;Acc:MGI:1328313]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23233 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092053 Nonsense 144 451 2 11

The following transcripts of ENSDARG00000063167 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7787508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATCGCTCTATAATGTATCTGCAGTGGAGGACTCAGTAACCTGCTGTA[C/A]ATGTGCAGTTTACCAGATGATGTTAAGCCGGCCGGGGTTGAACCTCGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c3vk44p4