ppwd1

Ensembl ID:
ENSDARG00000063161
ZFIN ID:
ZDB-GENE-070615-16
Description:
peptidylprolyl isomerase domain and WD repeat-containing protein 1 [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
PPWD1
Human Description:
peptidylprolyl isomerase domain and WD repeat containing 1 [Source:HGNC Symbol;Acc:28954]
Mouse Orthologue:
Ppwd1
Mouse Description:
peptidylprolyl isomerase domain and WD repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21680 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092047 Essential Splice Site 75 622 2 11
Genomic Location (Zv9):
Chromosome 10 (position 11734145)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11810011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAAGTTACATGCACAGAGATGTTATAACACACATTGTTTGCTCCAA[G/A]TAAGTGTTCACCAATTTTTGCCATGACCTGGTTAGGTTTGAACGTTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link