mapk8ip2

Ensembl ID:
ENSDARG00000063157
ZFIN ID:
ZDB-GENE-070705-326
Description:
Novel protein similar to H.sapiens mitogen-activated protein kinase 8 interacting protein [Source:Un
Human Orthologue:
MAPK8IP2
Human Description:
mitogen-activated protein kinase 8 interacting protein 2 [Source:HGNC Symbol;Acc:6883]
Mouse Orthologue:
Mapk8ip2
Mouse Description:
mitogen-activated protein kinase 8 interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1926555]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11080 Essential Splice Site Available for shipment Available now
sa23232 Nonsense Mutation detected in F1 DNA During 2014
sa16465 Essential Splice Site Available for shipment Available now
sa23231 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23230 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23229 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092033 Essential Splice Site 22 1242 None 13

The following transcripts of ENSDARG00000063157 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7750114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTAAAGAGAGAACTGGTGTGTTCATGATTAWTTTCTGTGTTGTCTGC[A/T]GGCCGGCTCATGACATCAGTCTGGAGGAGTTTGATGATGAAGATCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092033 Nonsense 583 1242 6 13

The following transcripts of ENSDARG00000063157 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7731068)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCCCCTGCCATCCCCTGTGAGGATAGCAGTTCTCAGCAGTTGTTGT[T/A]GAAGATTGAGCCTGACCACAGTCTTGAAAGCTTCAAACGCTCCTTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092033 Essential Splice Site 1002 1242 6 13

The following transcripts of ENSDARG00000063157 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7729810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCWAAGAAGTTCCTCAATGTGTTTGTCAATGGCACRTCACGGWCCTCCAG[T/G]AAGTGAAGATAAAACYGCACAATTWACTTAKGAGGCATTTTACCCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092033 Essential Splice Site 1027 1242 7 13

The following transcripts of ENSDARG00000063157 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7729186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTATAAATGGAGAAGAAAGAGATCAGACTCACAGAGCAGTCTTCAG[G/A]TGAGTAACGCTGCCCACATGAATAGCCTAGCTCTAATGAAAATGCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092033 Essential Splice Site 1027 1242 8 13

The following transcripts of ENSDARG00000063157 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7728998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATATCTATTGCAAGCAATCCTAATGCGAGTTTTAATGCCCATGCTGT[A/G]GGTTCATCCCACGACATGCAGATGAGCTGGAGTTAGATGTTGATGATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092033 Nonsense 1031 1242 8 13

The following transcripts of ENSDARG00000063157 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 7728986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCAATCCTAATGCGAGTTTTAATGCCCATGCTGTAGGTTCATCCCA[C/T]GACATGCAGATGAGCTGGAGTTAGATGTTGATGATCCGTTATTCGTTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g2vdrvzz