dcaf12

Ensembl ID:
ENSDARG00000063155
ZFIN ID:
ZDB-GENE-061013-363
Description:
DDB1- and CUL4-associated factor 12 [Source:UniProtKB/Swiss-Prot;Acc:Q08BB3]
Human Orthologues:
DCAF12, DCAF12L1, DCAF12L2
Human Descriptions:
DDB1 and CUL4 associated factor 12 [Source:HGNC Symbol;Acc:19911]
DDB1 and CUL4 associated factor 12-like 1 [Source:HGNC Symbol;Acc:29395]
DDB1 and CUL4 associated factor 12-like 2 [Source:HGNC Symbol;Acc:32950]
Mouse Orthologues:
Dcaf12, Dcaf12l1, Dcaf12l2
Mouse Descriptions:
DDB1 and CUL4 associated factor 12 Gene [Source:MGI Symbol;Acc:MGI:1916220]
DDB1 and CUL4 associated factor 12-like 1 Gene [Source:MGI Symbol;Acc:MGI:2444462]
DDB1 and CUL4 associated factor 12-like 2 Gene [Source:MGI Symbol;Acc:MGI:2445178]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14363 Nonsense Available for shipment Available now
sa23871 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092015 Nonsense 325 482 7 9
ENSDART00000133227   None 52 None 1
Genomic Location (Zv9):
Chromosome 21 (position 10329815)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11813178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYTTTGTGTTCTGTGANTTTTTCAGGAGCTTTCTACAAAACTCCCTTACTG[T/A]AAGGAGAATGTTTGTCTGGCTTACGGGCYGGACTGGTCTGTTTATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092015 Nonsense 340 482 7 9
ENSDART00000133227   None 52 None 1
Genomic Location (Zv9):
Chromosome 21 (position 10329860)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11813223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTAAGGAGAATGTTTGTCTGGCTTACGGGCTGGACTGGTCTGTTTA[T/A]GCAGTCGGTTCTCAGGCACACGTTTCCTTCCTCGACCCCCGGCAATCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link