si:ch211-127m10.2

Ensembl ID:
ENSDARG00000063153
ZFIN ID:
ZDB-GENE-061009-4
Description:
si:ch211-127m10.2 [Source:RefSeq peptide;Acc:NP_001094421]
Human Orthologue:
BCL11A
Human Description:
B-cell CLL/lymphoma 11A (zinc finger protein) [Source:HGNC Symbol;Acc:13221]
Mouse Orthologue:
Bcl11a
Mouse Description:
B-cell CLL/lymphoma 11A (zinc finger protein) Gene [Source:MGI Symbol;Acc:MGI:106190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12590 Nonsense Available for shipment Available now
sa33799 Nonsense Mutation detected in F1 DNA During 2017
sa33800 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092040 Nonsense 6 745 1 4
ENSDART00000140827 Nonsense 6 776 1 3
Genomic Location (Zv9):
Chromosome 6 (position 6408117)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6334133
KASP Assay ID:
2259-7081.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCAAWGTGAGCCCAGCTGAGACCGAGTCCAACATGTCTCGCCGCAAG[C/T]AGGGCAAACCCCAGCACTTAAGYAAACGGGAGTTTTCGCGTAAGTTACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092040 Nonsense 36 745 2 4
ENSDART00000140827 Nonsense 36 776 2 3
Genomic Location (Zv9):
Chromosome 6 (position 6415434)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6341450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGCCCGTGACGGCAGATATCCCAGAGGACGGGGAAAGCAATCCCGGAT[C/A]AGAACCATCCACCCCTAAAGGGGACCAGGACCTCCTCACCTGTGGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092040 Nonsense 454 745 4 4
ENSDART00000140827 Nonsense 485 776 3 3
Genomic Location (Zv9):
Chromosome 6 (position 6457457)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6383473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGAATGAAAGTGAGGCTGGTGAAAGGAATGATATAAACTTTAGCT[T/A]GAGCCTAGAAGGTGCACGTCATCACGAGAACAATAGACAACGACACAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link