nrxn2b

Ensembl ID:
ENSDARG00000063150
ZFIN ID:
ZDB-GENE-070206-7
Description:
Neurexin 2b beta [Source:UniProtKB/TrEMBL;Acc:A1XQX7]
Human Orthologue:
NRXN2
Human Description:
neurexin 2 [Source:HGNC Symbol;Acc:8009]
Mouse Orthologue:
Nrxn2
Mouse Description:
neurexin II Gene [Source:MGI Symbol;Acc:MGI:1096362]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20840 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091955 Nonsense 498 681 7 7
Genomic Location (Zv9):
Chromosome 7 (position 634443)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 480908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCACTGACCGGACCGTACTCCCACCTCCGCCTGGGGCCGGGAACCCT[C/T]GAGGTGACCGGCCCTTTGCACGTTTACCCAATTCCCACCGGCCACCGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link