tmtc1

Ensembl ID:
ENSDARG00000063149
ZFIN ID:
ZDB-GENE-070705-219
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW25]
Human Orthologue:
TMTC1
Human Description:
transmembrane and tetratricopeptide repeat containing 1 [Source:HGNC Symbol;Acc:24099]
Mouse Orthologue:
Tmtc1
Mouse Description:
transmembrane and tetratricopeptide repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:3039590]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13541 Essential Splice Site Available for shipment Available now
sa20209 Nonsense Available for shipment Available now
sa18061 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 163 872 2 20
ENSDART00000142892 Essential Splice Site 163 412 2 9
Genomic Location:
Chromosome 4 (position 8476646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCTCACCGCACTGCTKTTCTCTGTGCACCCCATTCACACTGAAGCTG[T/A]GAGTCTGCCAATACRACTAATACTAATATATGCATTACTAGTTATGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Nonsense 288 872 6 20
ENSDART00000142892 Nonsense 288 412 6 9
Genomic Location:
Chromosome 4 (position 8500515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTTCAGGTTACAGTCATCATGTCTGTCCGCTTATGGCTGATGGGT[G/T]GATCCATGCCGCTGTTCTCCGAGCAAGACAATCCTGCATCCTTCTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 372 872 8 20
ENSDART00000142892 Essential Splice Site 372 412 8 9
Genomic Location:
Chromosome 4 (position 8501373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTCTTGTCATGCTGGCATTRAGCCTGAACTGTGTTACATGCCTACAG[G/T]TGAGCGATTGAACGCACACATTTCCAMGTGACAAGACAACCTCTGAGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)
  • Schizophrenia: Genome-wide association study of multiplex schizophrenia pedigrees. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t7znbgdp