shisa7

Ensembl ID:
ENSDARG00000063144
ZFIN ID:
ZDB-GENE-060503-31
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LUE0]
Human Orthologue:
SHISA7
Human Description:
shisa homolog 7 (Xenopus laevis) [Source:HGNC Symbol;Acc:35409]
Mouse Orthologue:
Shisa7
Mouse Description:
shisa homolog 7 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:3605641]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36791 Nonsense Mutation detected in F1 DNA During 2017
sa23454 Nonsense Available for shipment Available now
sa15345 Nonsense Available for shipment Available now
sa10850 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092006 Nonsense 95 501 1 9
ENSDART00000148073 Nonsense 172 620 2 6
Genomic Location (Zv9):
Chromosome 19 (position 10858272)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10316811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCACCCAGCCCCCGGTCCGGCACGACCCAGATTTTGACCCGCTGCAA[C/T]AACAGAGCAACAACACCGCTTACGTCATTGGGGGAGTCATCTCTTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092006 Nonsense 127 501 1 9
ENSDART00000148073 Nonsense 204 620 2 6
Genomic Location (Zv9):
Chromosome 19 (position 10858176)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10316715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATGGCCGTAGCCATTGGGGTTAAAGTGGCCTTCCATAAACTGTCT[C/T]GACGGCCGAGGAACAGAGACATCAACATGCCTAGGTGAGTGACAGGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092006 Nonsense 147 501 2 9
ENSDART00000148073 Nonsense 224 620 3 6
Genomic Location (Zv9):
Chromosome 19 (position 10857938)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10316477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTWTYTCTCTRTGTTGTTCTTCAGAGCTCTGGTGGACATTCTGCGTCAC[C/T]AGTCCAGTCCGGTCCAGCAAGGAGAGAGRAACAACAGCACGGTCCTCRCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092006 Essential Splice Site 252 501 6 9
ENSDART00000148073 Essential Splice Site 348 620 5 6
ENSDART00000092006 Essential Splice Site 252 501 6 9
ENSDART00000148073 Essential Splice Site 348 620 5 6
Genomic Location (Zv9):
Chromosome 19 (position 10847683)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10306222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGTGATGAAACCAGAGCTTAACCGCTACAGCTCCCTCAAGAGACTGG[G/A]TAAGTGAGTGTGCNTGGTTTTGGTGGTTTACGAGGACACCAATTTATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link