si:ch73-60i13.2

Ensembl ID:
ENSDARG00000063141
ZFIN ID:
ZDB-GENE-030131-7119
Description:
Novel protein similar to vertebrate R3H domain containing 1 (R3HDM1) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
R3HDM1
Human Description:
R3H domain containing 1 [Source:HGNC Symbol;Acc:9757]
Mouse Orthologue:
R3hdm1
Mouse Description:
R3H domain 1 (binds single-stranded nucleic acids) Gene [Source:MGI Symbol;Acc:MGI:2448514]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37455 Nonsense Mutation detected in F1 DNA During 2017
sa24103 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091982 Nonsense 395 1028 11 23
ENSDART00000146322 Nonsense 50 729 1 13

The following transcripts of ENSDARG00000063141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12496022)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12341885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTGTGGCCCCTCATCCCTCTGCACCCATAGGGGGCAGCGCAGCCTCT[C/T]AGAGCAGCACTACTAACGCTAACATTAACGCTAACGCTAGCTTCTACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091982   None 1028 None 23
ENSDART00000146322 Essential Splice Site 587 729 11 13

The following transcripts of ENSDARG00000063141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12516378)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12362241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCATGTGGTCAACCACCACCATCATCACCATCTTCATCACCACCAG[G/A]TTGAACACGCACACACACTCTCACTCACTCATGATCGCACACATCCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link