si:dkey-21p9.4

Ensembl ID:
ENSDARG00000063140
ZFIN ID:
ZDB-GENE-091204-175
Human Orthologue:
EXD3
Human Description:
exonuclease 3'-5' domain containing 3 [Source:HGNC Symbol;Acc:26023]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10072 Essential Splice Site Available for shipment Available now
sa9133 Nonsense Mutation detected in F1 DNA During 2017
sa34858 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Essential Splice Site 164 861 4 19
ENSDART00000138041   None 339 None 8
Genomic Location (Zv9):
Chromosome 10 (position 10912582)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10988448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTTCAGTGTGAAAATGGAGCTCCAGTCAGATCTGGAYATGGAGAAGG[T/G]KAGTCTCTGTTCATCTGGACTGTTTTATTTCTGTGTGTTTGTGTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Nonsense 189 861 5 19
ENSDART00000138041   None 339 None 8
Genomic Location (Zv9):
Chromosome 10 (position 10912431)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10988297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACAAGCTGTCTCTGGCTGAGCTCTAYGTTCGTCATCATCCAGATCTG[C/T]AACAGAGACTCGTATCCCTCCTGGACTCCTGGTGCCGGCCAGACTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Nonsense 591 861 14 19
ENSDART00000138041 Nonsense 210 339 5 8
Genomic Location (Zv9):
Chromosome 10 (position 10901318)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10977184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGCCAGAGGATCTTCGCTCTATTCCCACAGCCCAGAAGCCCAAGAGC[C/T]AAGAGGAGAAAAAGCCCAAAGACAAGAAGCAGTTTAAAAGAAGAGAGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link