LOC798983

Ensembl ID:
ENSDARG00000063133
Human Orthologue:
SLC4A10
Human Description:
solute carrier family 4, sodium bicarbonate transporter, member 10 [Source:HGNC Symbol;Acc:13811]
Mouse Orthologue:
Slc4a10
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 Gene [Source:MGI Symbol;Ac

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41787 Nonsense Mutation detected in F1 DNA During 2016
sa41786 Nonsense Mutation detected in F1 DNA During 2016
sa13492 Nonsense Available for shipment Available now
sa35031 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6192 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21853 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Nonsense 288 1074 7 23
Genomic Location (Zv9):
Chromosome 11 (position 10777794)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10730108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACTTCATGAAAAAAATCCCACCGGGGGCTGAGGCGTCTAACATCT[T/A]GGTGGGTGAGCTGGAGTTTCTGGAGAAACCTGTGGTGGCCTTCATCCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Nonsense 399 1074 9 23
Genomic Location (Zv9):
Chromosome 11 (position 10777253)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10729567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGAATGGGATCCCACCATCAGAATAGAGCCACCTAAAAACGTGCCCT[C/A]ACAGGTAATCAGTGATCAAACTTTACTGTACATGCACTGATCCATAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Nonsense 514 1074 12 23
Genomic Location (Zv9):
Chromosome 11 (position 10773021)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10725335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTTTGGAGCCTCTATGACGGGTATTGCATACTCATTGTTTGCCGGG[C/T]AGCCCCTCACTATTCTGGGCAGTACAGGGCCTGTATTGGTCTTTGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Essential Splice Site 709 1074 16 23
Genomic Location (Zv9):
Chromosome 11 (position 10758086)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10710400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGAAATCTATATAATCTGTAATGTTGTTCTCTGTGTTATTTTGCAAC[A/G]GGTGAGGCAGATTATCAGTGATTTTGCTGTTTTCATCACCATCATGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Essential Splice Site 965 1074 20 23
Genomic Location (Zv9):
Chromosome 11 (position 10753343)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10705657
KASP Assay ID:
554-4727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGGGTCATTAAAACCTCCAGAGCCGCCATAGTCTTTCCAATGATGG[T/C]AGGACACCTATATTTATATGTATTTGAGTGTGTGCATGATCACCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Nonsense 1020 1074 22 23
Genomic Location (Zv9):
Chromosome 11 (position 10750995)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10703309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTTTTAGGAGAATCAGTGTGTCTTGATTGAGGATGAAGGGATTGTA[C/T]AAGTACCCCTAGAAGGACATTATAAGTAAGTTGGACAATTTTTAGTGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link