LOC798983

Ensembl ID:
ENSDARG00000063133
Human Orthologue:
SLC4A10
Human Description:
solute carrier family 4, sodium bicarbonate transporter, member 10 [Source:HGNC Symbol;Acc:13811]
Mouse Orthologue:
Slc4a10
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 Gene [Source:MGI Symbol;Ac

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3790 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13492 Nonsense Available for shipment Available now
sa3801 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6192 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21853 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Essential Splice Site 176 1074 4 23
Genomic Location:
Chromosome 11 (position 10784157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACCGTCATGCTGGACATGAGGGCCAGCTCACTRGAGGAGATCGCAGG[T/C]ACCAAACCAAAAGGGMTYTCTCATAGATWTAAAGAAATAAGCATTTAARY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Nonsense 514 1074 12 23
Genomic Location:
Chromosome 11 (position 10773021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTTTGGAGCCTCTATGACGGGTATTGCATACTCATTGTTTGCCGGG[C/T]AGCCCCTCACTATTCTGGGCAGTACAGGGCCTGTATTGGTCTTTGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Essential Splice Site 907 1074 19 23
Genomic Location:
Chromosome 11 (position 10755316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGGAGTTTTCCTTTATATGGGAGCATCGTCTCTCAGAGGCATACAGG[T/C]ACTGCATAAGGAAAGACAAATCAACCATGTCTCACAATTGTTTCTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Essential Splice Site 965 1074 20 23
Genomic Location:
Chromosome 11 (position 10753343)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGGGTCATTAAAACCTCCAGAGCCGCCATAGTCTTTCCAATGATGG[T/C]AGGACACCTATATTTATATGTATTTGAGTGTGTGCATGATCACCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091923 Nonsense 1020 1074 22 23
Genomic Location:
Chromosome 11 (position 10750995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTTTTAGGAGAATCAGTGTGTCTTGATTGAGGATGAAGGGATTGTA[C/T]AAGTACCCCTAGAAGGACATTATAAGTAAGTTGGACAATTTTTAGTGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jvfg1g0z