KCNMB3

Ensembl ID:
ENSDARG00000063129
Description:
potassium large conductance calcium-activated channel, subfamily M beta member 3 [Source:HGNC Symbol
Human Orthologues:
AP000547.1, KCNMB3
Human Descriptions:
potassium large conductance calcium-activated channel, subfamily M beta member 3 [Source:HGNC Symbol
Putative calcium-activated potassium channel subunit beta-3-like protein [Source:UniProtKB/Swiss-Pro
Mouse Orthologue:
AC130281.1
Mouse Description:
calcium-activated potassium channel subunit beta-3 [Source:RefSeq peptide;Acc:NP_001182003]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5715 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa5715
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091987 Nonsense 70 271 2 4
ENSDART00000091987 Nonsense 70 271 2 4
Genomic Location (Zv9):
Chromosome 2 (position 7622626)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8040280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGGGCTTCCTCATGATGACCTGCTCCATCCTCATGTACCTGATGGTG[G/T]GAATCTTAATGGTCAAACCGTGCATCCATAGGTTAGTTTCAGCRCTAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link