LOC793256

Ensembl ID:
ENSDARG00000063111
Human Orthologues:
C3AR1, C5AR1
Human Descriptions:
complement component 3a receptor 1 [Source:HGNC Symbol;Acc:1319]
complement component 5a receptor 1 [Source:HGNC Symbol;Acc:1338]
Mouse Orthologues:
C3ar1, C5ar1, Gpr33
Mouse Descriptions:
complement component 3a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1097680]
complement component 5a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88232]
G protein-coupled receptor 33 Gene [Source:MGI Symbol;Acc:MGI:1277106]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25086 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17050 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053336 Essential Splice Site 187 350 2 3
Genomic Location:
Chromosome 19 (position 11131537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAATGGCATTAAGAATCACTGTATGTTCACCTTGTATGAAAATGATA[T/A]ATGTATTTATAATTTATTTGATTTTACTTGCAGGTGAATGGGTCATCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053336 Nonsense 306 350 3 3
Genomic Location:
Chromosome 19 (position 11131925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCATTAACCCAATMTTGTACTTCTTCATGGGWCTGGATGTTAGTCGA[C/T]GATGCARCCAAAGTTTGTCTGGGATTTTTCKMAGAGCACTTAYGGAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qc0dqccq