crebbpb

Ensembl ID:
ENSDARG00000063102
ZFIN ID:
ZDB-GENE-050302-102
Description:
CBP-A [Source:UniProtKB/TrEMBL;Acc:Q1L668]
Human Orthologue:
CREBBP
Human Description:
CREB binding protein [Source:HGNC Symbol;Acc:2348]
Mouse Orthologue:
Crebbp
Mouse Description:
CREB binding protein Gene [Source:MGI Symbol;Acc:MGI:1098280]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa919 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 525 2424 8 31
Genomic Location:
Chromosome 3 (position 10040259)
KASP Assay ID:
554-0825.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAATGTCAAGCATGGTTTATAATCTAATGTYATTATCCCGCACCCAC[A/T]GCCAGATGATGCCCGACGGGTCGAATATGGGYGGCGCAGGGAACCTGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ys2g4qfg