crebbpb

Ensembl ID:
ENSDARG00000063102
ZFIN ID:
ZDB-GENE-050302-102
Description:
CBP-A [Source:UniProtKB/TrEMBL;Acc:Q1L668]
Human Orthologue:
CREBBP
Human Description:
CREB binding protein [Source:HGNC Symbol;Acc:2348]
Mouse Orthologue:
Crebbp
Mouse Description:
CREB binding protein Gene [Source:MGI Symbol;Acc:MGI:1098280]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38373 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33098 Essential Splice Site Mutation detected in F1 DNA During 2016
sa919 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 418 2424 5 31
Genomic Location:
Chromosome 3 (position 10029179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGTCTGTCTGCCCCTGAAAAATGCCAGTGACAAGAGAAACCAGCAGC[G/A]TAAGTCATCCTCACATTTACATCAACTACACACATGCAGATATTCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 419 2424 None 31
Genomic Location:
Chromosome 3 (position 10029180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCTGTCTGCCCCTGAAAAATGCCAGTGACAAGAGAAACCAGCAGCG[T/A]AAGTCATCCTCACATTTACATCAACTACACACATGCAGATATTCAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 525 2424 8 31
Genomic Location:
Chromosome 3 (position 10040259)
KASP Assay ID:
554-0825.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAATGTCAAGCATGGTTTATAATCTAATGTYATTATCCCGCACCCAC[A/T]GCCAGATGATGCCCGACGGGTCGAATATGGGYGGCGCAGGGAACCTGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link