LOC100333987

Ensembl ID:
ENSDARG00000063101
Human Orthologue:
MAN2A2
Human Description:
mannosidase, alpha, class 2A, member 2 [Source:HGNC Symbol;Acc:6825]
Mouse Orthologue:
Man2a2
Mouse Description:
mannosidase 2, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:2150656]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7259 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13130 Essential Splice Site Available for shipment Available now
sa3293 Nonsense F2 line generated During 2014
sa24615 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091894 Essential Splice Site 44 1151 1 22
Genomic Location:
Chromosome 25 (position 8901041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCCAGCACGATCCRGCCAGGAGACAGAAYGGYGGGAACTTTCCGAGGG[T/G]ACGTCGCCGATCSCCTTATRAAGTCTTTTTGTCCCMGATTACATTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091894 Essential Splice Site 526 1151 9 22
Genomic Location:
Chromosome 25 (position 8928921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCGACCCTTCTACAAAAACCTGGACCGYATTTTAGAATCTCACYTAAGG[T/C]TAGTCAGTCAATACATTAKACATTAGAYGCATCAGGANNNNNTCYAATAAACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3293
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091894 Nonsense 597 1151 11 22
Genomic Location:
Chromosome 25 (position 8936061)
KASP Assay ID:
554-2550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCTCCTCGTCTACCCACAGGCTGTTACGTTCTCTGGTGGGTCTGAAA[C/T]GAGTGATCATTAATGCAGCRCACTTCCTGATAATAAAGAATAAAGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091894 Nonsense 814 1151 15 22
Genomic Location:
Chromosome 25 (position 8943555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCCTCACCTACGGTACGCGACCCTCCAAGGACAAGAGCGGGGCCTA[T/A]CTGTTCCTGCCGGATGGAAATGCTAAGGTAGCGTCCGCTTGTCTTGCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xr74z907