psmd14

Ensembl ID:
ENSDARG00000063100
ZFIN ID:
ZDB-GENE-070410-56
Description:
26S proteasome non-ATPase regulatory subunit 14 [Source:RefSeq peptide;Acc:NP_001077042]
Human Orthologue:
PSMD14
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 [Source:HGNC Symbol;Acc:16889]
Mouse Orthologue:
Psmd14
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI Symbol;Acc:MGI:1913284]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12474 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091901 Nonsense 260 310 10 11
Genomic Location (Zv9):
Chromosome 11 (position 10896986)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10849300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATTCTACRTTTTTNNNNNNGTGTGTGTGTGTGTGTGTGTGTNNGTNNTTTTAGGCTGTA[G/T]AGGAAGAAGACAAGATGACTCCTGAGCAGCTTGCMATTAAGAACGTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link