ctsf

Ensembl ID:
ENSDARG00000063095
ZFIN ID:
ZDB-GENE-030131-9831
Description:
cathepsin F [Source:RefSeq peptide;Acc:NP_001071036]
Human Orthologue:
CTSF
Human Description:
cathepsin F [Source:HGNC Symbol;Acc:2531]
Mouse Orthologue:
Ctsf
Mouse Description:
cathepsin F Gene [Source:MGI Symbol;Acc:MGI:1861434]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28260 Nonsense Mutation detected in F1 DNA During 2015
sa17667 Essential Splice Site Available for shipment Available now
sa22423 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa28260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129898 Nonsense 79 473 1 15
Genomic Location:
Chromosome 14 (position 7164596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACGCGATGCATATACGTCGTGTCAGCAAAATCCTTTCGGCCAGCAAA[C/T]AGGTAACGTTAAATAAAAAATAATCCCTTAGAATTTCCGATTAACGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129898 Essential Splice Site 79 473 1 15
Genomic Location:
Chromosome 14 (position 7164593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCGATGCATATACGTCGTGTCAGCAAAATCCTTTCKGCCAGCAAAYAG[G/A]TAACGTTAAATAAAAAATAATCCCTTAGAATTTCYGATTAACGTKAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129898 Essential Splice Site 378 473 10 15
Genomic Location:
Chromosome 14 (position 7150001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGCCTACATTAACAGCTCAGTGGAGCTGCCCAAAGACGAGAAGGG[T/C]GAGTGAAAACACGATATGTGTCAATAAACTTAATTAATTGAAGAACACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bmigttu9