ctsf

Ensembl ID:
ENSDARG00000063095
ZFIN ID:
ZDB-GENE-030131-9831
Description:
cathepsin F [Source:RefSeq peptide;Acc:NP_001071036]
Human Orthologue:
CTSF
Human Description:
cathepsin F [Source:HGNC Symbol;Acc:2531]
Mouse Orthologue:
Ctsf
Mouse Description:
cathepsin F Gene [Source:MGI Symbol;Acc:MGI:1861434]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17667 Essential Splice Site Available for shipment Available now
sa22423 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129898 Essential Splice Site 79 473 1 15
Genomic Location:
Chromosome 14 (position 7164593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCGATGCATATACGTCGTGTCAGCAAAATCCTTTCKGCCAGCAAAYAG[G/A]TAACGTTAAATAAAAAATAATCCCTTAGAATTTCYGATTAACGTKAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129898 Essential Splice Site 378 473 10 15
Genomic Location:
Chromosome 14 (position 7150001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGCCTACATTAACAGCTCAGTGGAGCTGCCCAAAGACGAGAAGGG[T/C]GAGTGAAAACACGATATGTGTCAATAAACTTAATTAATTGAAGAACACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bmigttu9