abcg5

Ensembl ID:
ENSDARG00000063078
ZFIN ID:
ZDB-GENE-050517-40
Description:
ATP-binding cassette sub-family G member 5 [Source:RefSeq peptide;Acc:NP_001122162]
Human Orthologue:
ABCG5
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 5 [Source:HGNC Symbol;Acc:13886]
Mouse Orthologue:
Abcg5
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 5 Gene [Source:MGI Symbol;Acc:MGI:1351659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22240 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17622 Nonsense Available for shipment Available now
sa2683 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa22240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Essential Splice Site 92 652 2 13
Genomic Location:
Chromosome 13 (position 10513080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTTCATTTGGACAGTGGCCAGATAATGGGAATTCTTGGAAACTCAG[G/A]TAAATGTCTTAAAATCTGTGAGAAAAAGAATGACTGCAATGCTTTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Nonsense 128 652 3 13
Genomic Location:
Chromosome 13 (position 10513850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCWACCTYCAGGGAGAAGTGTTTGTGAATGGACGAAAGCTRAAAAGAGAA[C/T]AGTTTCAAGACTGTTTCTCTTMCGTTCTGCAGGTGAGATTAAWTGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2683
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Nonsense 436 652 9 13
Genomic Location:
Chromosome 13 (position 10525121)
KASP Assay ID:
554-2577.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAGGACCGAATCGGCCTAATCTACCAATCCATGGGTGCATCTCCCTA[T/A]ACCGGAATGCTGAATGCTGTGGCTCTATGTAAGTATACAGATAACAATCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8vodaxsg