gripap1

Ensembl ID:
ENSDARG00000063069
ZFIN ID:
ZDB-GENE-070112-922
Description:
GRIP1-associated protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001116792]
Human Orthologue:
GRIPAP1
Human Description:
GRIP1 associated protein 1 [Source:HGNC Symbol;Acc:18706]
Mouse Orthologue:
Gripap1
Mouse Description:
GRIP1 associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1859616]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa402 Essential Splice Site Available for shipment Available now
sa16570 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Essential Splice Site 102 867 5 28
ENSDART00000139414 None None 194 None 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10252408)
KASP Assay ID:
554-0369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGATTTCAGACTGCAGAACAGCACCCTCATGCAAGAGCTGTCCAAGG[T/C]GCTTTCATTATCATGAACATGTCAACACTGTAACTTTATGCACAAATGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Nonsense 791 867 27 28
ENSDART00000139414 None None 194 None 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10326617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTTTCTGTTTTTTTTTTTTTATATCTCAGATGTATCAGGAGGTGTT[G/T]GATTGGCTCATAGTGCTCAGCCKGACCGTGGAGRTTTGAGTTCGGTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jnvpn9q6