gripap1

Ensembl ID:
ENSDARG00000063069
ZFIN ID:
ZDB-GENE-070112-922
Description:
GRIP1-associated protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001116792]
Human Orthologue:
GRIPAP1
Human Description:
GRIP1 associated protein 1 [Source:HGNC Symbol;Acc:18706]
Mouse Orthologue:
Gripap1
Mouse Description:
GRIP1 associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1859616]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa402 Essential Splice Site Available for shipment Available now
sa34312 Nonsense Mutation detected in F1 DNA During 2016
sa31629 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16570 Nonsense Available for shipment Available now
sa34313 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Essential Splice Site 102 867 5 28
ENSDART00000139414   None 194 None 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10252408)
KASP Assay ID:
554-0369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGATTTCAGACTGCAGAACAGCACCCTCATGCAAGAGCTGTCCAAGG[T/C]GCTTTCATTATCATGAACATGTCAACACTGTAACTTTATGCACAAATGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Nonsense 388 867 16 28
ENSDART00000139414 Nonsense 140 194 7 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10276062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACAGATCCAAACAGTGAAGACTCAGGAACTGAATTTGCTGAGAGAG[C/T]AAAATCTTGCGCTGAACGCCGAGCTTCAGCAGAGACGTACTGACCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Essential Splice Site 785 867 26 28
ENSDART00000139414   None 194 None 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10305985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAAAAAAGCGCAATTATTGAGACGTACGTCATGGACAGCCGGAGAGG[T/C]AAAGCAGCTTTTCTCCATCCCTCTTTTGTCATTGTTCGCAGCCTCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Nonsense 791 867 27 28
ENSDART00000139414   None 194 None 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10326617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTTTCTGTTTTTTTTTTTTTATATCTCAGATGTATCAGGAGGTGTT[G/T]GATTGGCTCATAGTGCTCAGCCKGACCGTGGAGRTTTGAGTTCGGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111853 Essential Splice Site 841 867 27 28
ENSDART00000139414   None 194 None 8

The following transcripts of ENSDARG00000063069 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 10326771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAACATGCTGGAGGAACAACTGACAAAGAACATGCACCTACAGAAGG[T/G]AAAGAAAGAGATGAACAGCTACGGTTGAAGTCAGAATTATTAGCCCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link