abcg8

Ensembl ID:
ENSDARG00000063059
ZFIN ID:
ZDB-GENE-050517-41
Description:
ATP-binding cassette sub-family G member 8 [Source:RefSeq peptide;Acc:NP_001108041]
Human Orthologue:
ABCG8
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 8 [Source:HGNC Symbol;Acc:13887]
Mouse Orthologue:
Abcg8
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 8 Gene [Source:MGI Symbol;Acc:MGI:1914720]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22239 Nonsense Mutation detected in F1 DNA During 2014
sa22238 Nonsense Available for shipment Available now
sa7716 Nonsense Mutation detected in F1 DNA During 2014
sa19055 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091773 None None 256 2 9
ENSDART00000114315 Nonsense 55 332 2 6
ENSDART00000128765 Nonsense 32 654 1 13
ENSDART00000147541 Nonsense 33 654 1 12
Genomic Location:
Chromosome 13 (position 10509212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTTACAGCGGAGGCCGCAATGAACTGGAAGTCCGCAATCTCAACTA[T/G]GAGGTCAGACACTTCGGTCCACATTTTTGGTCTTTATTCTTTCCACTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091773 Nonsense 229 256 8 9
ENSDART00000114315 Nonsense 307 332 6 6
ENSDART00000128765 Nonsense 284 654 5 13
ENSDART00000147541 Nonsense 285 654 5 12
Genomic Location:
Chromosome 13 (position 10502035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTGGTCAGGCCAAAGACATGGTGTCTTACTTCACCACTCTCGGGTA[C/A]CCGTGTCCACGCTATTGCAACCCGTCCGACTACTACGGTGAGTGGGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091773 None None 256 None 9
ENSDART00000114315 None None 332 None 6
ENSDART00000128765 Nonsense 619 654 13 13
ENSDART00000147541 Nonsense 619 654 12 12
ENSDART00000091773 None None 256 None 9
ENSDART00000114315 None None 332 None 6
ENSDART00000128765 Nonsense 619 654 13 13
ENSDART00000147541 Nonsense 619 654 12 12
Genomic Location:
Chromosome 13 (position 10492443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTGAACTTGGTTTTCAGGTTGTGGAGATGATGAAGATGAACCAGTA[T/G]CCGCTGTTCTCCTGCTACCTGGTGCTTATTGCTGTTTCTTTGGTTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091773 None None 256 None 9
ENSDART00000114315 None None 332 None 6
ENSDART00000128765 Nonsense 619 654 13 13
ENSDART00000147541 Nonsense 619 654 12 12
ENSDART00000091773 None None 256 None 9
ENSDART00000114315 None None 332 None 6
ENSDART00000128765 Nonsense 619 654 13 13
ENSDART00000147541 Nonsense 619 654 12 12
Genomic Location:
Chromosome 13 (position 10492443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTGAACTTGGTTTTCAGGTTGTGGAGATGATGAAGATGAACCAGTA[T/G]CCGCTGTTCTCCTGCTACCTGGTGCTTATTGCTGTTTCTTTGGTTTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Gallstones: A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease. (View Study)
  • Phytosterol levels: Genetic regulation of serum phytosterol levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dqq1gb54