TULP4 (2 of 2)

Ensembl ID:
ENSDARG00000063056
Description:
tubby like protein 4 [Source:HGNC Symbol;Acc:15530]
Human Orthologue:
TULP4
Human Description:
tubby like protein 4 [Source:HGNC Symbol;Acc:15530]
Mouse Orthologue:
Tulp4
Mouse Description:
tubby like protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916092]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13784 Nonsense Available for shipment Available now
sa23000 Nonsense Mutation detected in F1 DNA During 2014
sa16367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091818 Nonsense 457 1548 8 18
Genomic Location:
Chromosome 17 (position 8039851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGTTCAGAGGAAAACCCTGAGGCTGGAGGCCCCTGTTATACCCTCTA[T/A]CTGGAACAYCTCGGAGGTCTGGTGCCTATTCTCAAGGGCCGTCGCAKCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091818 Nonsense 773 1548 14 18
Genomic Location:
Chromosome 17 (position 8042971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCCTCCCCCTCCACATCATCTGCCACAACCACCCCACCAACAACGT[C/T]AGCAACCACAAGACCATCAACAGTCAAAGCATCAACAGCAATTACAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091818 Nonsense 1513 1548 18 18
Genomic Location:
Chromosome 17 (position 8049358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATCAATTGCTTTTTCACCTAACCCATGATTCTCTATTACAGGTAATG[C/T]AGTTYGGCAGAATTGAYGGCAATGCATACATCCTGGACTTTCAGTAYCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s6nhjcce