bap1

Ensembl ID:
ENSDARG00000063051
ZFIN ID:
ZDB-GENE-050208-492
Description:
Ubiquitin carboxyl-terminal hydrolase BAP1 [Source:UniProtKB/Swiss-Prot;Acc:A1L2G3]
Human Orthologue:
BAP1
Human Description:
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) [Source:HGNC Symbol;Acc:950]
Mouse Orthologue:
Bap1
Mouse Description:
Brca1 associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1206586]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24088 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24087 Essential Splice Site Available for shipment Available now
sa24086 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091757 Essential Splice Site 41 724 None 17
ENSDART00000091774 Essential Splice Site 41 278 None 8
ENSDART00000091777 Essential Splice Site 41 755 None 17
Genomic Location:
Chromosome 22 (position 10712820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATAAGCGCTGTATATTTCATGTAACCTTCCTACATTTTCTTTTTCTC[A/G]GTCCTGTATATGGCTTCATCTTTCTTTTCAAATGGATCGAGGAGCGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091757 Essential Splice Site 551 724 13 17
ENSDART00000091774 Essential Splice Site 260 278 6 8
ENSDART00000091777 Essential Splice Site 582 755 13 17
Genomic Location:
Chromosome 22 (position 10703946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTCCAACTGCAAGAGGATGGAGTCATATTTGCCCTGCCACCTACAG[G/A]TACGCATTCAAAACTACAAGATTTAACTAGAGATGCACTGATTGACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091757 Essential Splice Site 657 724 16 17
ENSDART00000091774 None None 278 None 8
ENSDART00000091777 Essential Splice Site 688 755 16 17
Genomic Location:
Chromosome 22 (position 10703355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGATTTTGTCCTCAAAGTATGGAATGAGCTTATTGAGATATGTTTTC[A/T]GATTGATGACCAGAGGAGGACTCATAACTATGACGAGTTTATCTGCACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uqhj4cgg