si:ch211-243g18.1

Ensembl ID:
ENSDARG00000063050
ZFIN ID:
ZDB-GENE-060503-694
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LXV6]
Human Orthologues:
RC3H1, RC3H2
Human Descriptions:
ring finger and CCCH-type domains 1 [Source:HGNC Symbol;Acc:29434]
ring finger and CCCH-type domains 2 [Source:HGNC Symbol;Acc:21461]
Mouse Orthologues:
Rc3h1, Rc3h2
Mouse Descriptions:
RING CCCH (C3H) domains 1 Gene [Source:MGI Symbol;Acc:MGI:2685397]
ring finger and CCCH-type zinc finger domains 2 Gene [Source:MGI Symbol;Acc:MGI:2442789]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7344 Missense Mutation detected in F1 DNA During 2017
sa12985 Essential Splice Site Available for shipment Available now
sa13000 Essential Splice Site Available for shipment Available now
sa21674 Nonsense Available for shipment Available now
sa27566 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091780 Missense 18 1038 1 22
ENSDART00000147997 Missense 18 991 1 17
Genomic Location (Zv9):
Chromosome 10 (position 9692123)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9768079
KASP Assay ID:
554-4113.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCGGTGCAGGCAGCTCAATGGACCGAGTTTYTATCCTGCCCTATCTGC[T/C]ATAATGAGTTTGATGCCTGCAGCCACAAGCCMATCAGCCTSGGCTGCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091780 Essential Splice Site 525 1038 9 22
ENSDART00000147997 Essential Splice Site 523 991 9 17
ENSDART00000091780 Essential Splice Site 525 1038 9 22
ENSDART00000147997 Essential Splice Site 523 991 9 17
Genomic Location (Zv9):
Chromosome 10 (position 9717525)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9793481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCTGCTCAGTGGTGTTAAYGGATTGCATGTGACCAGCCTAGAACAG[T/C]AAGTGCACTTATTAGTGGAGTTAACTGAAGATTGTCATATTCATTGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091780 Essential Splice Site 525 1038 9 22
ENSDART00000147997 Essential Splice Site 523 991 9 17
ENSDART00000091780 Essential Splice Site 525 1038 9 22
ENSDART00000147997 Essential Splice Site 523 991 9 17
Genomic Location (Zv9):
Chromosome 10 (position 9717525)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9793481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCTGCTCAGTGGTGTTAAYGGATTGCATGTGACCAGCCTAGAACAG[T/C]AAGTGCACTTATTAGTGGAGTTAACTGAAGATTGTCATATTCATTGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091780 Nonsense 776 1038 15 22
ENSDART00000147997 Nonsense 739 991 13 17
Genomic Location (Zv9):
Chromosome 10 (position 9723592)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9799548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAGATAGAATGTTGTCATCGCTCTCTTTCTCCTCCTTTAGCATCCC[G/T]AGGGTGTAGGTGGTGGGCGTATGACTTGCAAGTGTCATGGTGGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091780 Splice Site None 1038 None 22
ENSDART00000147997 Essential Splice Site 858 991 14 17
Genomic Location (Zv9):
Chromosome 10 (position 9729498)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9805454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCACAGCATCACAGGGGTGCACCGGTACCACCTCCATCAACTTCAGAG[G/A]TTTAAATTTATATTGCATGTTGTGATTTTTGAATGTTTTTCTTCAGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link