btbd11b

Ensembl ID:
ENSDARG00000063040
ZFIN ID:
ZDB-GENE-050419-99
Description:
Ankyrin repeat and BTB/POZ domain-containing protein BTBD11-B [Source:UniProtKB/Swiss-Prot;Acc:P0C7A
Human Orthologue:
BTBD11
Human Description:
BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:23844]
Mouse Orthologue:
Btbd11
Mouse Description:
BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1921257]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8602 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32195 Nonsense Mutation detected in F1 DNA During 2016
sa23258 Nonsense Available for shipment Available now
sa39195 Nonsense Mutation detected in F1 DNA During 2016
sa2959 Essential Splice Site F2 line generated During 2016
sa23257 Nonsense Mutation detected in F1 DNA During 2016
sa16940 Nonsense Available for shipment Available now
sa12869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Essential Splice Site 405 1012 4 17
Genomic Location (Zv9):
Chromosome 18 (position 14570426)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15015844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTTACAATGTTTTTATAGCACWGTAATCACCTGTTGTCTCCCCCTGC[A/G]GGCCGTTTCTRGTGCTGCCTCCTCTGATGGAGTGGATCAGAGTGGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 697 1012 10 17
Genomic Location (Zv9):
Chromosome 18 (position 14555943)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15001361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCTGGAGGAGAGGAATTCCCTAAAGATGGAGGCGACCCGCACGGGG[A/T]AAGCCAAACTCAAAGCGCTGAGGGAGGCCATGTATCACAGCTCCGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 715 1012 10 17
Genomic Location (Zv9):
Chromosome 18 (position 14555887)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15001305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTCAAAGCGCTGAGGGAGGCCATGTATCACAGCTCCGAACATGGATA[C/A]GTCGACATCACCCTGGACATCAGAAGTCTAGGTCAGTTCCTGCTGTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 779 1012 11 17
Genomic Location (Zv9):
Chromosome 18 (position 14554617)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15000035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAATATACAGAGGAGCTCATCACACACGGCCTCCCTCTCATGTTC[C/T]AGATCCTGCGCGCCAGCAAGGTGAACTAAAACATTTACACATTTGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2959
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Essential Splice Site 820 1012 12 17
Genomic Location (Zv9):
Chromosome 18 (position 14549699)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14995117
KASP Assay ID:
554-2749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCATTCCAAAACTGACCRAGATCAAGAGGAAACAGACCTCAAGACTGG[G/A]TACGTACTGTAAAGAGATCAGCTTTCATCACCAGAACAAACTGACTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 922 1012 16 17
Genomic Location (Zv9):
Chromosome 18 (position 14545368)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14990786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTCTGCATCTAAGTTCTTCCAGCTGGAGGCATTACAGAGACACTG[T/A]GAGATCATCTGCGCCAAGAACATCAACACCGAAACTTGTGTGGAGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 976 1012 17 17
ENSDART00000091742 Nonsense 976 1012 17 17
Genomic Location (Zv9):
Chromosome 18 (position 14542346)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14987764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACATGGCRGTTCTCATAGAGCTTGAGCCATTTAAACAGTTGCTCTA[T/A]AACACCCCGGTGGAGAACTGCTGTCCTGACGTGTTGCATGACCTGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 976 1012 17 17
ENSDART00000091742 Nonsense 976 1012 17 17
Genomic Location (Zv9):
Chromosome 18 (position 14542346)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14987764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACATGGCRGTTCTCATAGAGCTTGAGCCATTTAAACAGTTGCTCTA[T/A]AACACCCCGGTGGAGAACTGCTGTCCTGACGTGTTGCATGACCTGGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link