LOC100334523

Ensembl ID:
ENSDARG00000063035
Human Orthologue:
NTRK3
Human Description:
neurotrophic tyrosine kinase, receptor, type 3 [Source:HGNC Symbol;Acc:8033]
Mouse Orthologue:
Ntrk3
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 3 Gene [Source:MGI Symbol;Acc:MGI:97385]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30361 Nonsense Mutation detected in F1 DNA During 2017
sa30360 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30359 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091728 Nonsense 125 613 4 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3515 (position 261308)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14538985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGACGAGCCGGAGCGCCGCCATCACACCTGTATCGAGTTCACGGTG[A/T]GAGGTTTTCCTCATCCCACACTGCACTGGTTCTACAAGGGCCGCGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091728 Essential Splice Site 204 613 4 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3515 (position 261069)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14539224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTGTCTTTGGCCATTTTCTTGATCCACCATTCATGGAGGATGACGG[T/A]AGGTCTGCATACTGTATTGTTTGTAATAAGGTATGATTGTATTCTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091728 Nonsense 490 613 10 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3515 (position 32574)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14670370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCGTAGGGAATGGGCTGCTGGTGAAGATTGGAGACTTCGGGATGTCC[A/T]GAGACATTTACAGCTCGGATTACTATCGAGTAAGTATCATAAGAATTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link