mlc1

Ensembl ID:
ENSDARG00000063026
ZFIN ID:
ZDB-GENE-050419-145
Description:
membrane protein MLC1 [Source:RefSeq peptide;Acc:NP_001098409]
Human Orthologue:
MLC1
Human Description:
megalencephalic leukoencephalopathy with subcortical cysts 1 [Source:HGNC Symbol;Acc:17082]
Mouse Orthologue:
Mlc1
Mouse Description:
megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human) Gene [Source:MGI Symbol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10246 Nonsense Available for shipment Available now
sa13089 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091729 Nonsense 69 391 2 12
ENSDART00000130141 Nonsense 73 395 1 11
ENSDART00000141893 Nonsense 70 392 1 11
Genomic Location:
Chromosome 18 (position 14523075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTGGATCAGCCTGGCCCGCTACATCCCTGCTTCAGCTACAGAGTCT[G/A]GCTTTACAGYGTGGTTGTAGGGGTAAGCAGATTTGCACCACCTTGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091729 Essential Splice Site 273 391 9 12
ENSDART00000130141 Essential Splice Site 277 395 8 11
ENSDART00000141893 Essential Splice Site 274 392 8 11
Genomic Location:
Chromosome 18 (position 14517879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGCCATCGCCAGCCATGTGGTGGCAGAAAATCCCAGCAAAAGTCTGG[T/A]GAGTCTCCATCAGGATCTCTCTCYAGCAATWATGAGCAGTGCAATCGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/44j314nh