mlc1

Ensembl ID:
ENSDARG00000063026
ZFIN ID:
ZDB-GENE-050419-145
Description:
membrane protein MLC1 [Source:RefSeq peptide;Acc:NP_001098409]
Human Orthologue:
MLC1
Human Description:
megalencephalic leukoencephalopathy with subcortical cysts 1 [Source:HGNC Symbol;Acc:17082]
Mouse Orthologue:
Mlc1
Mouse Description:
megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human) Gene [Source:MGI Symbol

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10246 Nonsense Available for shipment Available now
sa32194 Nonsense Mutation detected in F1 DNA During 2016
sa13089 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091729 Nonsense 69 391 2 12
ENSDART00000130141 Nonsense 73 395 1 11
ENSDART00000141893 Nonsense 70 392 1 11
Genomic Location:
Chromosome 18 (position 14523075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTGGATCAGCCTGGCCCGCTACATCCCTGCTTCAGCTACAGAGTCT[G/A]GCTTTACAGYGTGGTTGTAGGGGTAAGCAGATTTGCACCACCTTGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091729 Nonsense 212 391 7 12
ENSDART00000130141 Nonsense 216 395 6 11
ENSDART00000141893 Nonsense 213 392 6 11
Genomic Location:
Chromosome 18 (position 14518242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGGCCCAATGATTGTGACCCAAACATCGTTCCCCACTCGTCTTTTC[A/T]AGGCCTTCGCCGTGAGTCGCCTACAAATGAGATTACGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091729 Essential Splice Site 273 391 9 12
ENSDART00000130141 Essential Splice Site 277 395 8 11
ENSDART00000141893 Essential Splice Site 274 392 8 11
Genomic Location:
Chromosome 18 (position 14517879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGCCATCGCCAGCCATGTGGTGGCAGAAAATCCCAGCAAAAGTCTGG[T/A]GAGTCTCCATCAGGATCTCTCTCYAGCAATWATGAGCAGTGCAATCGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link