panx2

Ensembl ID:
ENSDARG00000063019
ZFIN ID:
ZDB-GENE-050419-55
Description:
Novel protein similar to vertebrate pannexin 2 (PANX2) [Source:UniProtKB/TrEMBL;Acc:Q1LUA3]
Human Orthologue:
PANX2
Human Description:
pannexin 2 [Source:HGNC Symbol;Acc:8600]
Mouse Orthologue:
Panx2
Mouse Description:
pannexin 2 Gene [Source:MGI Symbol;Acc:MGI:1890615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091722 Nonsense 371 604 4 7
ENSDART00000098662 Nonsense 371 580 4 6
ENSDART00000110262 Nonsense 371 651 4 7
ENSDART00000122948 Nonsense 361 472 2 3
Genomic Location (Zv9):
Chromosome 18 (position 14496593)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14942011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCGAGACCACATYAAGTCTCTCAACAGACTGGATTTTATCACCAAC[G/T]AGAGCGACCTCATGTATGATAATGTGGTGCGGCAGCTGCTGGCAGCGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link