antxr2b

Ensembl ID:
ENSDARG00000063011
ZFIN ID:
ZDB-GENE-080213-4
Description:
anthrax toxin receptor 2b [Source:RefSeq peptide;Acc:NP_001096038]
Human Orthologue:
ANTXR2
Human Description:
anthrax toxin receptor 2 [Source:HGNC Symbol;Acc:21732]
Mouse Orthologue:
Antxr2
Mouse Description:
anthrax toxin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1919164]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38779 Essential Splice Site Mutation detected in F1 DNA During 2016
sa860 Nonsense F2 line generated During 2016
sa38780 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091676 Essential Splice Site 156 487 5 17
ENSDART00000136364 Essential Splice Site 156 475 5 16
Genomic Location (Zv9):
Chromosome 10 (position 9287398)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9363354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGATGGAAAGCTGGAGGTTTTTATGAATGAACTTGCTATAAAAGAGG[T/A]ACAGTAGCAAACCACATATACGTGGACATTTGTGTTGCATAATCTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa860
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091676 Nonsense 305 487 11 17
ENSDART00000136364 Nonsense 305 475 11 16
Genomic Location (Zv9):
Chromosome 10 (position 9295160)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9371116
KASP Assay ID:
554-0763.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAGTCTGAATAATGGCCAGTMTTTCATTTCAACTCCCATCACAATATA[T/A]GCCACCACATGTGTGAGTACATATTATCCATGGAAATAATTTCGAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091676 Essential Splice Site 475 487 16 17
ENSDART00000136364   476 475 16 16
Genomic Location (Zv9):
Chromosome 10 (position 9300018)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9375974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACAATATGACAGAGTTGCTATTATGAGACCTACAGCAAATGATAAG[G/A]TACAGTAGCCACGTTTCCATTAAAAAAAAAGTTTGCATTAGCCTATTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link