APC2

Ensembl ID:
ENSDARG00000063007
Description:
adenomatosis polyposis coli 2 [Source:HGNC Symbol;Acc:24036]
Human Orthologue:
APC2
Human Description:
adenomatosis polyposis coli 2 [Source:HGNC Symbol;Acc:24036]
Mouse Orthologue:
Apc2
Mouse Description:
adenomatosis polyposis coli 2 Gene [Source:MGI Symbol;Acc:MGI:1346052]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31814 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41778 Nonsense Mutation detected in F1 DNA During 2016
sa12808 Nonsense Available for shipment Available now
sa4406 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa31814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091664 Essential Splice Site 241 2105 5 14
Genomic Location (Zv9):
Chromosome 11 (position 7442436)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7286539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAGGAACGTTTCGGCACCAGTGATGAGATGGTCCAGAGAACACAA[G/A]TAAGAACAGATTATAGATTTAATGCCACGTTTCACCGACAAAGATGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091664 Nonsense 1068 2105 14 14
Genomic Location (Zv9):
Chromosome 11 (position 7430412)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7274515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTTCAACAAAGGTTTCTTCAGAAACTAGCATACCAACTGTCAAGT[T/A]GTCTCCCTCCTATCAGCATGTTCCACTGATCCAGAGTGTTGCCAAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091664 Nonsense 1722 2105 14 14
Genomic Location (Zv9):
Chromosome 11 (position 7428451)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7272554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATACAAGATCAAGTCAACAGTTATCAGTCCCGCCAAAATGGTTTTCAC[A/T]GRATCAAACAAAATCTAATTTTAGAAGAAGCACCTCCATGCTACTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4406
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091664 Nonsense 1830 2105 14 14
Genomic Location (Zv9):
Chromosome 11 (position 7428127)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7272230
KASP Assay ID:
554-3589.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAAAAGGCAAGCTGCCCGAAAACGAAAAGCTGAGAAAAAGCACAAA[C/T]AAAAAGCTACTCTTCNNNNNNNNNNNNNNNNNNNNNNNNTTGATAATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link