APC2

Ensembl ID:
ENSDARG00000063007
Description:
adenomatosis polyposis coli 2 [Source:HGNC Symbol;Acc:24036]
Human Orthologue:
APC2
Human Description:
adenomatosis polyposis coli 2 [Source:HGNC Symbol;Acc:24036]
Mouse Orthologue:
Apc2
Mouse Description:
adenomatosis polyposis coli 2 Gene [Source:MGI Symbol;Acc:MGI:1346052]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12808 Nonsense Available for shipment Available now
sa4406 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa12808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091664 Nonsense 1722 2105 14 14
Genomic Location:
Chromosome 11 (position 7428451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATACAAGATCAAGTCAACAGTTATCAGTCCCGCCAAAATGGTTTTCAC[A/T]GRATCAAACAAAATCTAATTTTAGAAGAAGCACCTCCATGCTACTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4406
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091664 Nonsense 1830 2105 14 14
Genomic Location:
Chromosome 11 (position 7428127)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAAAAGGCAAGCTGCCCGAAAACGAAAAGCTGAGAAAAAGCACAAA[C/T]AAAAAGCTACTCTTCNNNNNNNNNNNNNNNNNNNNNNNNTTGATAATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/duzo7a0u