si:ch211-127h20.1

Ensembl ID:
ENSDARG00000063005
ZFIN ID:
ZDB-GENE-081104-113
Description:
anaphase-promoting complex subunit 7 [Source:RefSeq peptide;Acc:NP_001107057]
Human Orthologue:
ANAPC7
Human Description:
anaphase promoting complex subunit 7 [Source:HGNC Symbol;Acc:17380]
Mouse Orthologue:
Anapc7
Mouse Description:
anaphase promoting complex subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1929711]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34333 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091684 Nonsense 278 566 7 11
Genomic Location (Zv9):
Chromosome 8 (position 12274443)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11719206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGATGTCTCATCTGAAATTAACTGATATTTGTAGGTATGGACGTATA[C/A]GGCTATCTCATGGCCAGAGAGGGTCATCTGGAAGATGTGGAGGTTTTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link