pglyrp2

Ensembl ID:
ENSDARG00000062998
ZFIN ID:
ZDB-GENE-071227-1
Description:
peptidoglycan recognition protein 2 [Source:RefSeq peptide;Acc:NP_001038631]
Human Orthologue:
PGLYRP2
Human Description:
peptidoglycan recognition protein 2 [Source:HGNC Symbol;Acc:30013]
Mouse Orthologue:
Pglyrp2
Mouse Description:
peptidoglycan recognition protein 2 Gene [Source:MGI Symbol;Acc:MGI:1928099]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20643 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105116 Nonsense 303 458 3 5
Genomic Location (Zv9):
Chromosome 6 (position 9300793)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8259871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCATTCCTAGATGTATATGGGGTGCAGCGCCACCTCAGGTTCCTCTT[G/T]AACTCCTCTCTCCACCAATGTCATTTCTGTACATTCACCACACAGCAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link