si:dkey-14o18.2

Ensembl ID:
ENSDARG00000062995
ZFIN ID:
ZDB-GENE-060503-145
Description:
Novel protein similar to vertebrate neuronal pentraxin I (NPTX1) [Source:UniProtKB/TrEMBL;Acc:Q1LUT9
Human Orthologue:
NPTX1
Human Description:
neuronal pentraxin I [Source:HGNC Symbol;Acc:7952]
Mouse Orthologue:
Nptx1
Mouse Description:
neuronal pentraxin 1 Gene [Source:MGI Symbol;Acc:MGI:107811]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5918 Nonsense Mutation detected in F1 DNA During 2017
sa11823 Nonsense Available for shipment Available now
sa23450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 334 722 2 5
ENSDART00000139727 Nonsense 155 416 2 5
Genomic Location (Zv9):
Chromosome 19 (position 10364123)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9822662
KASP Assay ID:
554-3835.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGTTCATTGCGAGACCTCCTGCAACGCAAAATCAACACACTGGAAGAA[C/T]AGCTTCATCATCATTACGACAGTCACTACGGTCACTATGATCACCACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 572 722 3 5
ENSDART00000139727 Nonsense 266 416 3 5
Genomic Location (Zv9):
Chromosome 19 (position 10360726)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9819265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCTCGGGTCCTGGCCTCGGAACCCCGTTCTCCTACTCTGTCCCTGGA[C/T]AAGCCAACGAGCTCGTCCTCAYTGAGTGGGGCAACAAWCCCATKGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 653 722 4 5
ENSDART00000139727 Nonsense 347 416 4 5
Genomic Location (Zv9):
Chromosome 19 (position 10357852)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9816391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCTGGCATCCCATTAAACCAGGAGGAGTCTTCATTCTTGGCCAAGAG[C/T]AGGTATGGTCTTACTGAATCAAACTTAAAGCTTATACTTTTTAAGCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link